#This program counts the number of different bases in a given DNA sequence.
#Written by Ilkka Kronholm, March 2007

$seq = "atcgtgactgatgctgatcgatgatagtcatcga"; #Sequence of interest

#Initial values for some variables
$no_of_a = 0;
$no_of_c = 0;
$no_of_t = 0;
$no_of_g = 0;
$position = 0;

$length_of_seq = length( $seq );

print "The sequence is $length_of_seq base pairs long\n";
print "\n";

#Next for-loop counts the number of bases. Each base has its own if-statement

for( $position; $position < $length_of_seq; $position++ )
{
	if (substr( $seq, $position, 1 ) eq "a" )
	{
		$no_of_a++;
	}
	if (substr( $seq, $position, 1 ) eq "c" )
	{
		$no_of_c++;
	}
	if (substr( $seq, $position, 1 ) eq "t" )
	{
		$no_of_t++;
	}
	if (substr( $seq, $position, 1 ) eq "g" )
	{
		$no_of_g++;
	}
}

# Previous could have also been done with a while-loop. Alternative solution commented out.
#while ( $position < $length_of_seq )
#{
#	if (substr( $seq, $position , 1 ) eq "a" )
#	{
#		$no_of_a++;
#	}
#	$position++;
#}

print "Number of A's is $no_of_a \n";
print "Number of T's is $no_of_t \n";
print "Number of C's is $no_of_c \n";
print "Number of G's is $no_of_g \n";

print "\n";

#We also want to count how many times some dimers and trimers appear in a given sequence

$position = 0; #Variable position is set again to zero.

#Here initial values for different dimers and trimers are set.

#Dimers
$no_of_at = 0;
$no_of_ct = 0;
$no_of_ag = 0;
$no_of_cc = 0;

#Trimers
$no_of_gat = 0;
$no_of_tga = 0;
$no_of_cat = 0;


for( $position; $position < $length_of_seq; $position++ )
{
	if( substr( $seq, $position, 2 ) eq "at" )
	{
		$no_of_at++;
	}
	
	if( substr( $seq, $position, 2 ) eq "ct" )
	{
		$no_of_ct++;
	}
	
	if( substr( $seq, $position, 2 ) eq "ag" )
	{
		$no_of_ag++;
	}
	
	if( substr( $seq, $position, 2 ) eq "cc" )
	{
		$no_of_cc++;
	}
}

$position = 0; #Again position must be reset to begin counting from the beginning.

for( $position; $position < $length_of_seq; $position++ )
{
	if( substr( $seq, $position, 3 ) eq "gat" )
	{
		$no_of_gat++;
	}
	
	if( substr( $seq, $position, 3 ) eq "tga" )
	{
		$no_of_tga++;
	}
	
	if( substr( $seq, $position, 3 ) eq "cat" )
	{
		$no_of_cat++;
	}
	
}

print "Dimer 'at' occurs $no_of_at times in the given sequence\n";
print "Dimer 'ct' $no_of_ct times\n";
print "Dimer 'ag' $no_of_ag times\n";
print "Dimer 'cc' $no_of_cc times\n";

print "\n";

print "Trimer 'gat' occurs $no_of_gat times in the given sequence\n";
print "Trimer 'tga' $no_of_tga times\n";
print "Trimer 'cat' $no_of_cat times\n";